Review



pcris pitchv2 bsd dtag brd4  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pcris pitchv2 bsd dtag brd4
    Pcris Pitchv2 Bsd Dtag Brd4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pmc13039271-258-29-31
    Average 93 stars, based on 34 article reviews
    pcris pitchv2 bsd dtag brd4 - by Bioz Stars, 2026-10
    93/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Loss of CFIm activates YAP/TAZ and connects mRNA cleavage and polyadenylation inhibition to BRCAness
    Article Snippet: .. PITCh dTAG donor vectors for NUDT21 targeting were generated by insertion of custom guide RNA sequences using the following plasmids: pX330-BbsI-PITCh (Addgene, 127875), pCRIS-PITChv2-BSD-dTAG (BRD4) (Addgene, 91792), pCRIS-PITChv2-Puro-dTAG (BRD4) (Addgene, 91793). .. The following plasmids were obtained from Addgene and were used without modification: a lentiviral vector encoding doxycycline-inducible YAP1-S127/397A (Addgene, 213585), NEDD4 and NEDD4L expression plasmids (Addgene, 27002 & 27000).

    Construct:

    Article Title: A nuclear RNA degradation code for eukaryotic transcriptome surveillance
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795; https://www.addgene.org/91795/ and Addgene plasmid # 91792; https://www.addgene.org/91792/ ). ..

    Article Title: The competition between splicing and 3′ processing shapes the human transcriptome
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and replaced the microhomology sequences with those from INTS11 using In Fusion cloning (Takara). pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795 ; https://www.addgene.org/91795/ and Addgene plasmid # 91792 ; https://www.addgene.org/91792/ ). ..

    Article Title: LENG8 mediates RNA nuclear retention and degradation in eukaryotes
    Article Snippet: .. Donor vectors were constructed by modifying pCRIS-PITChv2-dTAG-BSD (BRD4) (Addgene, #91795) and pCRIS-PITChv2-BSD-dTAG (BRD4) (Addgene, #91792) to replace the HA tag with a 3×FLAG tag. .. Subsequently, gene-specific microhomology arms for ZFC3H1, ZNF207, LENG8, and ZC3H3 were introduced via In-Fusion cloning (Takara).


    Plasmid Preparation:

    Article Title: A nuclear RNA degradation code for eukaryotic transcriptome surveillance
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795; https://www.addgene.org/91795/ and Addgene plasmid # 91792; https://www.addgene.org/91792/ ). ..

    Article Title: The competition between splicing and 3′ processing shapes the human transcriptome
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and replaced the microhomology sequences with those from INTS11 using In Fusion cloning (Takara). pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795 ; https://www.addgene.org/91795/ and Addgene plasmid # 91792 ; https://www.addgene.org/91792/ ). ..

    Article Title: Zinc-finger proteins with a co-opted capsid domain anchor nucleosomes over transposon sequences
    Article Snippet: To establish a HAP1 cell line with its endogenous ZNF24 gene tagged with an FKBP12 F36V degron, the cells were first sorted based on cellular sizes with FACSAria II (BD Biosciences) to enrich for haploid cells as previously described ( ). .. The repair template plasmid construction and sgRNA cloning were performed as previously described ( , ). pCRIS-PITChv2-BSD-dTAG (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91792 ; http://n2t.net/addgene:91792 ; RRID:Addgene_91792) and pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875 ; http://n2t.net/addgene:127875 ; RRID:Addgene_127875). .. The constructed pCRIS-PITChv2-BSD-dTAG (ZNF24) and pX330-BbsI-PITCh (ZNF24) were transfected to the sorted HAP1 cells with TransIT-LT1 (Mirus Bio, MIR 2306).


    Modification:

    Article Title: A nuclear RNA degradation code for eukaryotic transcriptome surveillance
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795; https://www.addgene.org/91795/ and Addgene plasmid # 91792; https://www.addgene.org/91792/ ). ..

    Article Title: The competition between splicing and 3′ processing shapes the human transcriptome
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and replaced the microhomology sequences with those from INTS11 using In Fusion cloning (Takara). pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795 ; https://www.addgene.org/91795/ and Addgene plasmid # 91792 ; https://www.addgene.org/91792/ ). ..


    Cloning:

    Article Title: A nuclear RNA degradation code for eukaryotic transcriptome surveillance
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and then replaced the microhomology sequences for EXOSC3 or ZFC3H1 using In Fusion cloning (Takara). pCRIS-PITChv2-dTAG-BSD (BRD4) and pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795; https://www.addgene.org/91795/ and Addgene plasmid # 91792; https://www.addgene.org/91792/ ). ..

    Article Title: The competition between splicing and 3′ processing shapes the human transcriptome
    Article Snippet: .. To construct the donor vector, we modified pCRIS-PITCHv2-BSD-dTAG (BRD4) to replace the HA tag with a 3X-FLAG tag and replaced the microhomology sequences with those from INTS11 using In Fusion cloning (Takara). pCRIS-PITCHv2-BSD-dTAG (BRD4) were gifts from James Bradner & Behnam Nabet (Addgene plasmid # 91795 ; https://www.addgene.org/91795/ and Addgene plasmid # 91792 ; https://www.addgene.org/91792/ ). ..

    Article Title: Zinc-finger proteins with a co-opted capsid domain anchor nucleosomes over transposon sequences
    Article Snippet: To establish a HAP1 cell line with its endogenous ZNF24 gene tagged with an FKBP12 F36V degron, the cells were first sorted based on cellular sizes with FACSAria II (BD Biosciences) to enrich for haploid cells as previously described ( ). .. The repair template plasmid construction and sgRNA cloning were performed as previously described ( , ). pCRIS-PITChv2-BSD-dTAG (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91792 ; http://n2t.net/addgene:91792 ; RRID:Addgene_91792) and pX330-BbsI-PITCh was a gift from Peter Kaiser (Addgene plasmid # 127875 ; http://n2t.net/addgene:127875 ; RRID:Addgene_127875). .. The constructed pCRIS-PITChv2-BSD-dTAG (ZNF24) and pX330-BbsI-PITCh (ZNF24) were transfected to the sorted HAP1 cells with TransIT-LT1 (Mirus Bio, MIR 2306).


    Amplification:

    Article Title: CHK1 is an integral regulator of DNA replication in human cells
    Article Snippet: .. The 5′ and 3′ homology arms of CHK1 were amplified by PCR using genomic DNA as the template, and the Blasticidin-P2A-2×HA-FKBP12 F36V -linker cassette was amplified by PCR from pCRIS-PITChv2-BSD-dTAG (BRD4) (Addgene #91792). .. A CHK1 N-terminal-specific guide RNA (gRNA) expression vector was constructed by inserting the gRNA sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), located near the CHK1 ATG start codon, into the PX330 vector (Addgene #42230).

    Polymerase Chain Reaction:

    Article Title: CHK1 is an integral regulator of DNA replication in human cells
    Article Snippet: .. The 5′ and 3′ homology arms of CHK1 were amplified by PCR using genomic DNA as the template, and the Blasticidin-P2A-2×HA-FKBP12 F36V -linker cassette was amplified by PCR from pCRIS-PITChv2-BSD-dTAG (BRD4) (Addgene #91792). .. A CHK1 N-terminal-specific guide RNA (gRNA) expression vector was constructed by inserting the gRNA sequence (CHK1-N-gRNA2: AGTGCCCTTTGTGGAAGACT), located near the CHK1 ATG start codon, into the PX330 vector (Addgene #42230).

    Sequencing:


    Western Blot:




    Similar Products

    93
    Addgene inc pcris pitchv2 bsd dtag brd4
    Pcris Pitchv2 Bsd Dtag Brd4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pmc13039271-258-29-31
    Average 93 stars, based on 1 article reviews
    pcris pitchv2 bsd dtag brd4 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcrispitchv2 bsd dtag brd4
    Pcrispitchv2 Bsd Dtag Brd4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pm41888112-455-27-29
    Average 93 stars, based on 1 article reviews
    pcrispitchv2 bsd dtag brd4 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcris pitchv2 dtag bsd brd4
    Pcris Pitchv2 Dtag Bsd Brd4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-dTAG-BSD+(BRD4)+(Plasmid+%2391795)/pm41861815-298-39-41
    Average 93 stars, based on 1 article reviews
    pcris pitchv2 dtag bsd brd4 - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc blasticidin resistance
    Blasticidin Resistance, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/bio_rxiv__64898__2026__01__31__702994-190-63-66
    Average 93 stars, based on 1 article reviews
    blasticidin resistance - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcris pitchv2 bsd dtag plasmid
    Pcris Pitchv2 Bsd Dtag Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pm41270757-271-8-10
    Average 93 stars, based on 1 article reviews
    pcris pitchv2 bsd dtag plasmid - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pcris pitchv2 bsd dtag brd4 plasmid
    Pcris Pitchv2 Bsd Dtag Brd4 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pmc12603752-29-21-25
    Average 93 stars, based on 1 article reviews
    pcris pitchv2 bsd dtag brd4 plasmid - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    93
    Addgene inc addgene plasmid
    Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcris+pitchv2+bsd+dtag+brd4/pCRIS-PITChv2-BSD-dTAG+(BRD4)+(Plasmid+%2391792)/pm41109217-296-78-78
    Average 93 stars, based on 1 article reviews
    addgene plasmid - by Bioz Stars, 2026-10
    93/100 stars
      Buy from Supplier

    Image Search Results